human codon optimized cas9 Search Results


96
Boster Bio rabbit anti cleaved caspase 9
Rabbit Anti Cleaved Caspase 9, supplied by Boster Bio, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+codon+optimized+cas9/Anti-Caspase-3+CASP3+Antibody/pmc05840745-41-26-69
Average 96 stars, based on 1 article reviews
rabbit anti cleaved caspase 9 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

96
Addgene inc crispr cas9 knockout
Crispr Cas9 Knockout, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+codon+optimized+cas9/CRISPR-SP-Cas9+reporter+(Plasmid+%2362733)/pmc09110385-169-0-36
Average 96 stars, based on 1 article reviews
crispr cas9 knockout - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

96
Addgene inc human codon optimized cas9 gene
Figure 1. Strategy for generating cellular and mouse models of chromosomal translocation via the ESC- and <t>CRISPR/Cas9-based</t> technologies. (a) Strategy for generating mESC models, or mESC-derived cellular models, and mouse models carrying a chromosomal translocation. (b) Strategy for generating site-specific chromosomal translocations in mESCs using the CRISPR/Cas9 system. Cdx2 and Gsk3α sgRNAs will guide Cas9 (blue) onto the indicated target sites located in mouse chromosome 5 (red) and chromosome 7 (green), respectively. DSBs will then be induced in these two sites. By activating NHEJ, DSBs can be repaired and the chromosomal translocation T (5:7) may occur in the designated location, thus generating two translocated chromosomes. To show the precise location and the relative length of the chromosomes, the chromosome graphs from the University of California Santa Cruz (UCSC) Genome Browser were used. Primer chr-short-p1 was designed to anneal to chromosome 7 at the site upstream of the predicted DSB point. Primer chr-short-p2 was designed to anneal downstream of the chromosome 5 DSB point. The size of PCR product is expected to be approximately 930 bp if the translocation occurs. Similarly, primers chr-long-p1 and chr-long-p2 were designed to detect T (5:7) chromosome-long, and the size of the PCR product is approximately 300 bp.
Human Codon Optimized Cas9 Gene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+codon+optimized+cas9/hCas9+(Plasmid+%2341815)/pm26898344-125-0-10
Average 96 stars, based on 1 article reviews
human codon optimized cas9 gene - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

96
Addgene inc sp cas9 gene
Figure 1. Strategy for generating cellular and mouse models of chromosomal translocation via the ESC- and <t>CRISPR/Cas9-based</t> technologies. (a) Strategy for generating mESC models, or mESC-derived cellular models, and mouse models carrying a chromosomal translocation. (b) Strategy for generating site-specific chromosomal translocations in mESCs using the CRISPR/Cas9 system. Cdx2 and Gsk3α sgRNAs will guide Cas9 (blue) onto the indicated target sites located in mouse chromosome 5 (red) and chromosome 7 (green), respectively. DSBs will then be induced in these two sites. By activating NHEJ, DSBs can be repaired and the chromosomal translocation T (5:7) may occur in the designated location, thus generating two translocated chromosomes. To show the precise location and the relative length of the chromosomes, the chromosome graphs from the University of California Santa Cruz (UCSC) Genome Browser were used. Primer chr-short-p1 was designed to anneal to chromosome 7 at the site upstream of the predicted DSB point. Primer chr-short-p2 was designed to anneal downstream of the chromosome 5 DSB point. The size of PCR product is expected to be approximately 930 bp if the translocation occurs. Similarly, primers chr-long-p1 and chr-long-p2 were designed to detect T (5:7) chromosome-long, and the size of the PCR product is approximately 300 bp.
Sp Cas9 Gene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+codon+optimized+cas9/SP-Cas9+(Plasmid+%2362731)/pmc06318785-406-4-28
Average 96 stars, based on 1 article reviews
sp cas9 gene - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

96
Addgene inc crispr cas9 method 53
Figure 1. Strategy for generating cellular and mouse models of chromosomal translocation via the ESC- and <t>CRISPR/Cas9-based</t> technologies. (a) Strategy for generating mESC models, or mESC-derived cellular models, and mouse models carrying a chromosomal translocation. (b) Strategy for generating site-specific chromosomal translocations in mESCs using the CRISPR/Cas9 system. Cdx2 and Gsk3α sgRNAs will guide Cas9 (blue) onto the indicated target sites located in mouse chromosome 5 (red) and chromosome 7 (green), respectively. DSBs will then be induced in these two sites. By activating NHEJ, DSBs can be repaired and the chromosomal translocation T (5:7) may occur in the designated location, thus generating two translocated chromosomes. To show the precise location and the relative length of the chromosomes, the chromosome graphs from the University of California Santa Cruz (UCSC) Genome Browser were used. Primer chr-short-p1 was designed to anneal to chromosome 7 at the site upstream of the predicted DSB point. Primer chr-short-p2 was designed to anneal downstream of the chromosome 5 DSB point. The size of PCR product is expected to be approximately 930 bp if the translocation occurs. Similarly, primers chr-long-p1 and chr-long-p2 were designed to detect T (5:7) chromosome-long, and the size of the PCR product is approximately 300 bp.
Crispr Cas9 Method 53, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+codon+optimized+cas9/CAG-Cas9+(Plasmid+%2389995)/pmc05458115__mmc2-170-14-42
Average 96 stars, based on 1 article reviews
crispr cas9 method 53 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

97
Addgene inc bicistronic cas9 sgrna vector
(a) Experimental schematic. Cultured cells were co-transfected with a single <t>Cas9-sgRNA</t> construct (CRISPR) and a complex homology-directed repair (HDR) library containing an edited exon that harbors a random hexamer (blue, green, orange) and a fixed selective PCR site (red). CRISPR-induced cutting stimulated homologous recombination with the HDR library, inserting mutant exons into the genomes of many cells. At five days post-transfection, cells were harvested for gDNA and RNA. After reverse transcription, selective PCR was performed followed by sequencing of gDNA and cDNA derived amplicons. Hexamer enrichment scores were calculated by dividing cDNA counts normalized by gDNA counts. (b) Correlation of enrichment scores between biological replicates for hexamers observed in each experiment with positions of previously identified exonic splicing enhancers (ESEs), exonic splicing silencers (ESSs) and stop codons indicated. (c) Rank-ordered plot of enrichment scores with positions of ESEs, ESSs, and stop codons indicated.
Bicistronic Cas9 Sgrna Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+codon+optimized+cas9/Cas9+sgRNA+vector+(Plasmid+%2368463)/pmc04156553-37-1-38
Average 97 stars, based on 1 article reviews
bicistronic cas9 sgrna vector - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

93
Addgene inc crispr cas9 knockout shrnas against human rab27a
Figure 7. Targeting <t>Rab27a</t> by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).
Crispr Cas9 Knockout Shrnas Against Human Rab27a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+codon+optimized+cas9/Human+CRISPR+Knockout+Library+(H3)+(Pooled+library+%23133914)/pm37805922-233-32-61
Average 93 stars, based on 1 article reviews
crispr cas9 knockout shrnas against human rab27a - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

92
Addgene inc cas9
Figure 7. Targeting <t>Rab27a</t> by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).
Cas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+codon+optimized+cas9/pMSCVpuro-Cas9-EGFP+(Plasmid+%23159126)/us11957747-323-14-31
Average 92 stars, based on 1 article reviews
cas9 - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier

96
Addgene inc human codon optimized cas9
Figure 7. Targeting <t>Rab27a</t> by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).
Human Codon Optimized Cas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+codon+optimized+cas9/lentiCRISPR+v2+(Plasmid+%2352961)/10__1158_slash_0008___5472__can___17___1240-81-1-4
Average 96 stars, based on 1 article reviews
human codon optimized cas9 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

95
Danaher Inc nucleotide protospacer sequence crrna
Figure 7. Targeting <t>Rab27a</t> by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).
Nucleotide Protospacer Sequence Crrna, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+codon+optimized+cas9/Alt-R+CRISPR-Cas9+Negative+Control+crRNA/bio_rxiv__2023__05__05__539557-335-2-6
Average 95 stars, based on 1 article reviews
nucleotide protospacer sequence crrna - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

96
Danaher Inc cas9
( A ) IL-12 production by WT and Cish −/− GM-MØs stimulated with GpG or LPS for 20 hrs. *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. (B ) Production of IL-12 by WT (Ly5.1) and Cish −/− (Ly5.2) GM-MØs derived from co-cultures with BM cells from individual mice. Harvested cells were stimulated with CpG for 4 hrs. ***P<0.001 by t test. ( C ) IL-12 production by spleen cells from WT and Cish −/− mice. Mice were engrafted with B16-GM for 9 days. Spleen cells were stimulated with CpG or LPS for 20 hrs. Bar graphs show mean ± SD of IL-12 concentration in culture supernatants. *P<0.05, **P<0.01 by t test. ( D ) IL-12 production by spleen MØs of WT and Cish −/− mice. Mix bone marrow chimera mice reconstituted with both WT (Ly5.1) and Cish −/− (Ly5.2) BM cells were engrafted with B16-GM for 9 days. Sorted MØs were stimulated with CpG for 20 hrs. Line graphs show IL-12 production by paired spleen MØs of WT and Cish −/− mice from the same hosts. *P<0.05, **P<0.01 by t test. ( E&F ) IL-12 production by human GM-MØs with Cish deletion. Human cord blood CD34 + cells were transfected with <t>Cas9</t> assemble RNP and Cish guide RNA. Transfected CD34 + cells were cultured with human GM-CSF (5 ng/ml) for 7 days. Cells were stimulated with CpG or LPS. FACS plots show resulted human GM-MØ population ( E ). Bar graphs show IL-12 production by human GM-MØs ( F ). *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. Data are representative of three independent experiments.
Cas9, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+codon+optimized+cas9/Alt-R+S%2Ep%2E+Cas9+Nuclease+V3/bio_rxiv__2022__03__31__486495-250-16-17
Average 96 stars, based on 1 article reviews
cas9 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

99
Thermo Fisher gene exp actb mm02619580 g1
( A ) IL-12 production by WT and Cish −/− GM-MØs stimulated with GpG or LPS for 20 hrs. *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. (B ) Production of IL-12 by WT (Ly5.1) and Cish −/− (Ly5.2) GM-MØs derived from co-cultures with BM cells from individual mice. Harvested cells were stimulated with CpG for 4 hrs. ***P<0.001 by t test. ( C ) IL-12 production by spleen cells from WT and Cish −/− mice. Mice were engrafted with B16-GM for 9 days. Spleen cells were stimulated with CpG or LPS for 20 hrs. Bar graphs show mean ± SD of IL-12 concentration in culture supernatants. *P<0.05, **P<0.01 by t test. ( D ) IL-12 production by spleen MØs of WT and Cish −/− mice. Mix bone marrow chimera mice reconstituted with both WT (Ly5.1) and Cish −/− (Ly5.2) BM cells were engrafted with B16-GM for 9 days. Sorted MØs were stimulated with CpG for 20 hrs. Line graphs show IL-12 production by paired spleen MØs of WT and Cish −/− mice from the same hosts. *P<0.05, **P<0.01 by t test. ( E&F ) IL-12 production by human GM-MØs with Cish deletion. Human cord blood CD34 + cells were transfected with <t>Cas9</t> assemble RNP and Cish guide RNA. Transfected CD34 + cells were cultured with human GM-CSF (5 ng/ml) for 7 days. Cells were stimulated with CpG or LPS. FACS plots show resulted human GM-MØ population ( E ). Bar graphs show IL-12 production by human GM-MØs ( F ). *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. Data are representative of three independent experiments.
Gene Exp Actb Mm02619580 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+codon+optimized+cas9/Gene+Exp%2E+Actb%2C+Mm02619580_g1/pm32516591-268-266-264
Average 99 stars, based on 1 article reviews
gene exp actb mm02619580 g1 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

Image Search Results


Figure 1. Strategy for generating cellular and mouse models of chromosomal translocation via the ESC- and CRISPR/Cas9-based technologies. (a) Strategy for generating mESC models, or mESC-derived cellular models, and mouse models carrying a chromosomal translocation. (b) Strategy for generating site-specific chromosomal translocations in mESCs using the CRISPR/Cas9 system. Cdx2 and Gsk3α sgRNAs will guide Cas9 (blue) onto the indicated target sites located in mouse chromosome 5 (red) and chromosome 7 (green), respectively. DSBs will then be induced in these two sites. By activating NHEJ, DSBs can be repaired and the chromosomal translocation T (5:7) may occur in the designated location, thus generating two translocated chromosomes. To show the precise location and the relative length of the chromosomes, the chromosome graphs from the University of California Santa Cruz (UCSC) Genome Browser were used. Primer chr-short-p1 was designed to anneal to chromosome 7 at the site upstream of the predicted DSB point. Primer chr-short-p2 was designed to anneal downstream of the chromosome 5 DSB point. The size of PCR product is expected to be approximately 930 bp if the translocation occurs. Similarly, primers chr-long-p1 and chr-long-p2 were designed to detect T (5:7) chromosome-long, and the size of the PCR product is approximately 300 bp.

Journal: Scientific reports

Article Title: Induction of site-specific chromosomal translocations in embryonic stem cells by CRISPR/Cas9.

doi: 10.1038/srep21918

Figure Lengend Snippet: Figure 1. Strategy for generating cellular and mouse models of chromosomal translocation via the ESC- and CRISPR/Cas9-based technologies. (a) Strategy for generating mESC models, or mESC-derived cellular models, and mouse models carrying a chromosomal translocation. (b) Strategy for generating site-specific chromosomal translocations in mESCs using the CRISPR/Cas9 system. Cdx2 and Gsk3α sgRNAs will guide Cas9 (blue) onto the indicated target sites located in mouse chromosome 5 (red) and chromosome 7 (green), respectively. DSBs will then be induced in these two sites. By activating NHEJ, DSBs can be repaired and the chromosomal translocation T (5:7) may occur in the designated location, thus generating two translocated chromosomes. To show the precise location and the relative length of the chromosomes, the chromosome graphs from the University of California Santa Cruz (UCSC) Genome Browser were used. Primer chr-short-p1 was designed to anneal to chromosome 7 at the site upstream of the predicted DSB point. Primer chr-short-p2 was designed to anneal downstream of the chromosome 5 DSB point. The size of PCR product is expected to be approximately 930 bp if the translocation occurs. Similarly, primers chr-long-p1 and chr-long-p2 were designed to detect T (5:7) chromosome-long, and the size of the PCR product is approximately 300 bp.

Article Snippet: Human codon optimized Cas9 gene was cloned from hCas9 plasmid (Addgene plasmid 41815) and inserted into the revised piggyBac expression vector with hygromycin resistance.

Techniques: Translocation Assay, CRISPR, Derivative Assay

Figure 2. Translocation between chromosome 5 and chromosome 7 mediated by the CRISPR/Cas9. (a) PCR analysis with chr-short-p1 and chr-short-p2 primers showing the presence of a ~930 bp PCR product in E14-Cas9 mESCs infected with Cdx2 and Gsk3α -sgRNAs. (b) Sequence of the PCR product (in one pMD18-T clone) of the predicted T (5:7) chromosome-short, and one cytosine nucleotide was deleted at the junction point. (c) PCR analysis with chr-long-p1 and chr-long-p2 primers showing the presence of a ~300 bp PCR product in E14-Cas9 mESCs infected with Cdx2 and Gsk3α sgRNAs. (d) Sequencing of the PCR product (in one pMD18-T clone) of the predicted T (5:7) chromosome-long indicates the addition of five nucleotides at the junction point. (e) Fluorescent images of the metaphase chromosomes of mESCs labelled with chromosome 5 (red) and 7 (green) specific probes. Insets zoomed in the two translocated chromosomes. Scale bars represent 10 μ m.

Journal: Scientific reports

Article Title: Induction of site-specific chromosomal translocations in embryonic stem cells by CRISPR/Cas9.

doi: 10.1038/srep21918

Figure Lengend Snippet: Figure 2. Translocation between chromosome 5 and chromosome 7 mediated by the CRISPR/Cas9. (a) PCR analysis with chr-short-p1 and chr-short-p2 primers showing the presence of a ~930 bp PCR product in E14-Cas9 mESCs infected with Cdx2 and Gsk3α -sgRNAs. (b) Sequence of the PCR product (in one pMD18-T clone) of the predicted T (5:7) chromosome-short, and one cytosine nucleotide was deleted at the junction point. (c) PCR analysis with chr-long-p1 and chr-long-p2 primers showing the presence of a ~300 bp PCR product in E14-Cas9 mESCs infected with Cdx2 and Gsk3α sgRNAs. (d) Sequencing of the PCR product (in one pMD18-T clone) of the predicted T (5:7) chromosome-long indicates the addition of five nucleotides at the junction point. (e) Fluorescent images of the metaphase chromosomes of mESCs labelled with chromosome 5 (red) and 7 (green) specific probes. Insets zoomed in the two translocated chromosomes. Scale bars represent 10 μ m.

Article Snippet: Human codon optimized Cas9 gene was cloned from hCas9 plasmid (Addgene plasmid 41815) and inserted into the revised piggyBac expression vector with hygromycin resistance.

Techniques: Translocation Assay, CRISPR, Infection, Sequencing

(a) Experimental schematic. Cultured cells were co-transfected with a single Cas9-sgRNA construct (CRISPR) and a complex homology-directed repair (HDR) library containing an edited exon that harbors a random hexamer (blue, green, orange) and a fixed selective PCR site (red). CRISPR-induced cutting stimulated homologous recombination with the HDR library, inserting mutant exons into the genomes of many cells. At five days post-transfection, cells were harvested for gDNA and RNA. After reverse transcription, selective PCR was performed followed by sequencing of gDNA and cDNA derived amplicons. Hexamer enrichment scores were calculated by dividing cDNA counts normalized by gDNA counts. (b) Correlation of enrichment scores between biological replicates for hexamers observed in each experiment with positions of previously identified exonic splicing enhancers (ESEs), exonic splicing silencers (ESSs) and stop codons indicated. (c) Rank-ordered plot of enrichment scores with positions of ESEs, ESSs, and stop codons indicated.

Journal: Nature

Article Title: Saturation Editing of Genomic Regions by Multiplex Homology-Directed Repair

doi: 10.1038/nature13695

Figure Lengend Snippet: (a) Experimental schematic. Cultured cells were co-transfected with a single Cas9-sgRNA construct (CRISPR) and a complex homology-directed repair (HDR) library containing an edited exon that harbors a random hexamer (blue, green, orange) and a fixed selective PCR site (red). CRISPR-induced cutting stimulated homologous recombination with the HDR library, inserting mutant exons into the genomes of many cells. At five days post-transfection, cells were harvested for gDNA and RNA. After reverse transcription, selective PCR was performed followed by sequencing of gDNA and cDNA derived amplicons. Hexamer enrichment scores were calculated by dividing cDNA counts normalized by gDNA counts. (b) Correlation of enrichment scores between biological replicates for hexamers observed in each experiment with positions of previously identified exonic splicing enhancers (ESEs), exonic splicing silencers (ESSs) and stop codons indicated. (c) Rank-ordered plot of enrichment scores with positions of ESEs, ESSs, and stop codons indicated.

Article Snippet: A bicistronic Cas9-sgRNA vector designed to cleave within BRCA1 exon 18 (“pCas9-sgBRCA1x18”) was cloned according to a published protocol by ligating annealed oligonucleotides into a human codon-optimized S. pyogenous Cas9-sgRNA vector from the lab of Feng Zhang (pX330-U6-Chimeric_BB-CBh-hSpCas9; Addgene plasmid #42230).

Techniques: Cell Culture, Transfection, Construct, CRISPR, Random Hexamer Labeling, Homologous Recombination, Mutagenesis, Sequencing, Derivative Assay

Figure 7. Targeting Rab27a by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).

Journal: Cell reports

Article Title: Upregulation of exosome secretion from tumor-associated macrophages plays a key role in the suppression of anti-tumor immunity.

doi: 10.1016/j.celrep.2023.113224

Figure Lengend Snippet: Figure 7. Targeting Rab27a by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).

Article Snippet: Murine TNF-a: 50-GGTGCCTATGTCTCAGCCTCTT-30 and 50-GCCATAGAA CTGA TGAGAGGGAG-3’; Murine IL-1b: 50- TGGACCTTCCAGGATGAGGACA-3’; Murine IL-6: 50-T ACCACTTCACAAGTCG GAGGC-30 and 50- CTGCAAGTGCATCA TCGTTG TTC-3’; TGF-b: 50-TGATACGCCTGAGTGGCTGTCT-3’; GAPDH: 50-CATCACT GCCACC CAGAAGACTG-30 and 50-ATGCCAGTGAGCTTCCCGTTCAG-3’. shRNA knockdown and CRISPR-Cas9 knockout shRNAs against human RAB27A (NM_004850, GCTGCCAATGGGACAAACATA, CAGGAGAGGTTTCGTAGCTA),96 mouse RAB27A (NM_001301230.1, CGAAACTGGATAA GCCAGCTA, GACAAACATAAGCCACGCGAT), human MADD (NG_029462.1, CCACAAGT ACAAGACGCCAAT, CCTGAAAGTATTTGGGCTAAA), mouse MADD (NM_001177720.1, CCACAAGTACAAGACGCCAAT, CCGCTCATTTATGGCAATGAT) or scrambled shRNA (Addgene, Catalog Number:1864) were co-transfected with viral packaging plasmids to package lentiviral particles using HEK293T cells.

Techniques: Expressing, Clinical Proteomics

( A ) IL-12 production by WT and Cish −/− GM-MØs stimulated with GpG or LPS for 20 hrs. *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. (B ) Production of IL-12 by WT (Ly5.1) and Cish −/− (Ly5.2) GM-MØs derived from co-cultures with BM cells from individual mice. Harvested cells were stimulated with CpG for 4 hrs. ***P<0.001 by t test. ( C ) IL-12 production by spleen cells from WT and Cish −/− mice. Mice were engrafted with B16-GM for 9 days. Spleen cells were stimulated with CpG or LPS for 20 hrs. Bar graphs show mean ± SD of IL-12 concentration in culture supernatants. *P<0.05, **P<0.01 by t test. ( D ) IL-12 production by spleen MØs of WT and Cish −/− mice. Mix bone marrow chimera mice reconstituted with both WT (Ly5.1) and Cish −/− (Ly5.2) BM cells were engrafted with B16-GM for 9 days. Sorted MØs were stimulated with CpG for 20 hrs. Line graphs show IL-12 production by paired spleen MØs of WT and Cish −/− mice from the same hosts. *P<0.05, **P<0.01 by t test. ( E&F ) IL-12 production by human GM-MØs with Cish deletion. Human cord blood CD34 + cells were transfected with Cas9 assemble RNP and Cish guide RNA. Transfected CD34 + cells were cultured with human GM-CSF (5 ng/ml) for 7 days. Cells were stimulated with CpG or LPS. FACS plots show resulted human GM-MØ population ( E ). Bar graphs show IL-12 production by human GM-MØs ( F ). *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. Data are representative of three independent experiments.

Journal: bioRxiv

Article Title: CIS calibrates GM-CSF signalling strength to regulate macrophage polarization via a STAT5-IRF8 axis

doi: 10.1101/2022.03.31.486495

Figure Lengend Snippet: ( A ) IL-12 production by WT and Cish −/− GM-MØs stimulated with GpG or LPS for 20 hrs. *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. (B ) Production of IL-12 by WT (Ly5.1) and Cish −/− (Ly5.2) GM-MØs derived from co-cultures with BM cells from individual mice. Harvested cells were stimulated with CpG for 4 hrs. ***P<0.001 by t test. ( C ) IL-12 production by spleen cells from WT and Cish −/− mice. Mice were engrafted with B16-GM for 9 days. Spleen cells were stimulated with CpG or LPS for 20 hrs. Bar graphs show mean ± SD of IL-12 concentration in culture supernatants. *P<0.05, **P<0.01 by t test. ( D ) IL-12 production by spleen MØs of WT and Cish −/− mice. Mix bone marrow chimera mice reconstituted with both WT (Ly5.1) and Cish −/− (Ly5.2) BM cells were engrafted with B16-GM for 9 days. Sorted MØs were stimulated with CpG for 20 hrs. Line graphs show IL-12 production by paired spleen MØs of WT and Cish −/− mice from the same hosts. *P<0.05, **P<0.01 by t test. ( E&F ) IL-12 production by human GM-MØs with Cish deletion. Human cord blood CD34 + cells were transfected with Cas9 assemble RNP and Cish guide RNA. Transfected CD34 + cells were cultured with human GM-CSF (5 ng/ml) for 7 days. Cells were stimulated with CpG or LPS. FACS plots show resulted human GM-MØ population ( E ). Bar graphs show IL-12 production by human GM-MØs ( F ). *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. Data are representative of three independent experiments.

Article Snippet: CIS RNPs were assembled by incubating 1ml of 30mM CIS sgRNA (5’-CTCACCAGATTCCCGAAGGT-3’; Synthego), 1.7ml of 67nM Cas9 (Integrated DNA Technologies #1081058), 1ml of electroporation enhancer (Integrated DNA Technologies #1075915) and 1.3ml PBS for 10min at room temperature.

Techniques: Comparison, Derivative Assay, Concentration Assay, Transfection, Cell Culture